Marker Assisted Selection in Wheat - HOME USDA National Institute of Food and Agriculture The Borlaug Global Rust Initiative Marker Assisted Selection in Wheat

Functional markers for genes affecting agronomic traits in wheat

Trait Locus Marker Primer sequence (5-3) Allele Expected fragment size Chromo- some Reference
Reduction in plant height
MASWheat link
Rht-B1 BF-WR1

BF: GGTAGGGAGGCGAGAGGCGAG
WR1: CATCCCCATGGCCATCTCGAGCTG

Rht-B1a 237 4BS
         
    BF-MR1 F: CCAGATACACAACTGCTGGC
R: TGATCTTGAGGTTCTCGTCG
Rht-B1b 237  
           
  Rht-D1

DF2-WR2

DF2: GGCAAGCAAAAGCTTCGCG
WR2: GGCCATCTCGAGCTGCAC
Rht-D1a 264 4DS
           
   

DF-MR2

DF: CGCGCAATTATTGGCCAGAGATAG
MR2: CCCCATGGCCATCTCGAGCTGCTA
Rht-D1b 254  
           
Photoperiod response
Ppd-D1 * Ppd-D1_F: ACGCCTCCCACTACACTG
Ppd-D1_R2: CACTGGTGGTAGCTGAGATT
Ppd-D1_R1: GTTGGTTCAAACAGAGAGC
Ppd-D1a 288 2DS
    Ppd-D1b 414  
Vernalization
MASWheat link
VRN-A1 * VRN1AF: GAAAGGAAAAATTCTGCTCG
VRN1-INT1R: GCAGGAAATCGAAATCGAAG
Vrn-A1a 965+876 5AL
    Vrn-A1b 714  
    Vrn-A1c 734    
    Vrn-A1 734  
    * Intr1/A/F2: AGCCTCCACGGTTTGAAAGTAA
Intr1/A/R3: AAGTAAGACAACACGAATGTGAGA
Vrn-A1c 1170  
    * Intr1/C/F: GCACTCCTAACCCACTAACC
Intr1/AB/R: TCATCCATCATCAAGGCAAA
Vrn-A1 1068    
    * Ex1/C/F: GTTCTCCACCGAGTCATGGT
Intr1/A/R3: AAGTAAGACAACACGAATGTGAGA
Vrn-A1 522    
  VRN-B1 * Intr1/B/F: CAAGTGGAACGGTTAGGACA
Intr1/B/R3: CTCATGCCAAAAATTGAAGATGA
Vrn-B1 709 5BL
    * Intr1/B/F: CAAGTGGAACGGTTAGGACA
Intr1/B/R4: CAAATGAAAAGGAATGAGAGCA
Vrn-B1 1149    
    * VRNBPF1: CCCCTGCTACCAGTGCCTACTA
VBINSR1: CCCGCTTGTTGGCTGGTGAG
Vrn-B1 928  
    * VRNBPF1: CCCCTGCTACCAGTGCCTACTA
VRNBPR1: GCCCCATCTCCGCTGGAGAACG
vrn-B1 989
 
  VRN-D1 * Intr1/D/F: GTTGTCTGCCTCATCAAATCC
Intr1/D/R3: GGTCACTGGTGGTCTGTGC
Vrn-D1 1671 5DL
      Intr1/D/F: GTTGTCTGCCTCATCAAATCC
Intr1/D/R4: AAATGAAAAGGAACGAGAGCG
vrn-D1 997    
  VRN-H1 * Intr1/H/F1: GCTCCAGCTGATGAAACTCC
Intr1/H/R1: CTTCATGGTTTTGCAAGCTCC
Vrn-H1 474 7HS
    * Intr1/H/F3: TTCATCATGGATCGCCAGTA
Intr1/H/R3: AAAGCTCCTGCCAACTACGA
Vrn-H1 403
 
  VRN-B3 * VRN4-B-INS-F: CATAATGCCAAGCCGGTGAGTAC
VRN4-B-INS-R: ATGTCTGCCAATTAGCTAGC
Vrn-B3 ~1200 7BS
    * VRN4-BNOINS-F: ATGCTTTCGCTTGCCATCC
VRN4-BNOINS-R: CTATCCCTACCGGCCATTAG
Vrn-B3 ~1140
 
Kernel weight TaSus2-2B Sus2-SNP-185/589H2 Sus2-SNP-185: TAAGCGATGAATTATGGC
Sus2-SNP-589H2: GGTGTCCTTGAGCTTCTGG
Hap-H 423 2BS
    Sus2-SNP-227/589L2 Sus2-SNP-227: CTATAGTATGAGCTGGATCAATGGC
Sus2-SNP-589L2: GGTGTCCTTGAGCTTCTGA
Hap-L 381
381
  TaGW2-6A

Hap-6A-P1

F: CGTTACCTCTGGTTTGGGTGTCGTG
R: CACCTCTCGAAAATCTTCCCAATTA

TaGW2-6A

949 6AS
    Hap-6A-P2 F: GAGAAAGGGCTGGTGCTATGGA
R: GTAACGCTTGATAAACATAGGTAAT
TaGW2-6A 418    

TaCwi-A1

CW122 F: GGTGATGAGTTCATGGTTAAT
R: AGAAGCCCAACATTAAATCAAC
TaCwi-A1a 402 2AL
    CW121 F: GTGGTGATGAGTTCATGGTTAAG
R: AGAAGCCCAACATTAAATCAAC
TaCwi-A1b
404
   
Abiotic stress tolerance
Dreb-B1 * P18F: CCCAACCCAAGTGATAATAATCT
P18R: TTGTGCTCCTCATGGGTACTT
Dreb-B1 717
3BL
Wei et al. 2009

References

Beales J, Turner A, Griffiths S, Snape JW, Laurie DA (2007) A pseudo-response regulator is misexpressed in the photoperiod insensitive Ppd-D1a mutant of wheat (Triticum aestivum L.). Theor Appl Genet 115:721–733. DOI:10.1007/s00122-007-0603-4

Chu CG, Tan CT, Yu GT, Zhong S, Xu SS, Yan LL (2011) A novel retrotransposon inserted in the dominant Vrn-B1 allele confers spring growth habit in tetraploid wheat (Triticum turgidum L.). G3 (Genes, Genomes, Genetics) 1:637–645. DOI:10.1534/g3.111.001131

Ellis MH, Spielmeyer W, Gale KR, Rebetzke GJ, Richards RA (2002) ‘‘Perfect’’ markers for the Rht-B1b and Rht-D1b dwarfing genes in wheat. Theor Appl Genet 105:1038–1042. DOI:10.1007/s00122-002-1048-4

Fu DL, Szücs P, Yan LL, Helguera M, Skinner JS, Zitzewitz JV, Hayes PM, Dubcovsky J (2005) Large deletions within the first intron in VRN-1 are associated with spring growth habit in barley and wheat. Mol Gen Genomics 273:54–65. DOI:10.1007/s00438-004-1095-4

Jiang QY, Hou J, Hao CY, Wang LF, Ge HG, Dong YS, Zhang XY (2011) The wheat (T. aestivum) sucrose synthase 2 gene (TaSus2) active in endosperm development is associated with yield traits. Funct Integr Genomics 11:49–61. DOI:10.1007/s10142-010-0188-x

Ma DY, Yan J, He ZH, Wu L, Xia XC (2012) Characterization of a cell wall invertase gene TaCwi-A1 on common wheat chromosome 2A and development of functional markers. Mol Breed 29:43–52.
DOI:10.1007/s11032-010-9524-z

Su ZQ, Hao CY, Wang LF, Dong YC, Zhang XY (2011) Identification and development of a functional marker of TaGW2
associated with grain weight in bread wheat (Triticum aestivum L.). Theor Appl Genet 122:211–223.
DOI:10.1007/s00122-010-1437-z

Wei B, Jing RL, Wang CS, Chen JB, Mao XG, Chang XP, Jia JZ (2009) Dreb1 genes in wheat (Triticum aestivum L.):development of functional markers and gene mapping based on SNPs. Mol Breed 23:13–22.
DOI:10.1007/s11032-008-9209-z

Yan LL, Helguera M, Kato K, Fukuyama S, Sherman J, Dubcovsky J (2004) Allelic variation at the VRN-1 promoter region in polyploid wheat. Theor Appl Genet 109:1677–1686. DOI:10.1007/s00122-004-1796-4

Yan LL, Fu DL, Li C, Blechl A, Tranquilli G, Bonafede M, Sanchez A, Valarik M, Yasuda S, Dubcovsky J (2006) The wheat and barley vernalization gene VRN3 is an orthologue of FT. Proc Natl Acad Sci USA 103:19581–19586. DOI:10.1073/pnas.0607142103

Back to protocols main page