Marker Assisted Selection in Wheat - HOME USDA National Institute of Food and Agriculture The Borlaug Global Rust Initiative Marker Assisted Selection in Wheat

Functional markers for disease resistance genes in wheat

Trait Locus Marker Primer sequence (5-3) Allele Expected fragment size Chromo- some Reference
Powdery mildew resistance
Pm3 Pm3a Pm3a/F: GGAGTCTCTTCGCATAGA
Pm3a/R: CAGCTTCTAAGATCAAGGAT
Pm3a 634 1AS
         
    Pm3b Pm3b/F: GGCACAGACAAAGCTCTG
Pm3b/R: TCGAGTAGCTCGGGAATC
Pm3b 1382    
    Pm3c Pm3c/F: CTAGTGGAGGTAGTTGAC
Pm3c/R: AGTCGTTCAAGAGAACGGC
Pm3c 846  
   

Pm3d

Pm3d/F: TGACTATTCGTGGGTGCA
Pm3d/R: GACTGCGGCACAGTTCAGC
Pm3d 1109  
    Pm3e Pm3e/F: GGAATCCCTTTGGCTTGT
Pm3e/R: CTAGCAGAGCAGTGCAAG
Pm3e 524    
   

Pm3f

Pm3f/F: GGAGTCTCTTTGCTTAAG
Pm3f/R: CAGCTTCTAAGATCAAGGAT
Pm3f 624  
    Pm3g Pm3g/F: GAATCCCTTTATCTTGAC
Pm3g/R: ATTCCCCTAGCAGAGCAGAA
Pm3g 540    
Leaf rust, stripe rust, and powdery mildew resistance
MASWheat link
Lr34/Yr18/
Pm38
cssfr1 L34DINT9F: TTGATGAAACCAGTTTTTTTTCTA
L34PLUSR: GCCATTTAACATAATCATGATGGA
+Lr34 965+876 7DS
    cssfr2 L34DINT9F: TTGATGAAACCAGTTTTTTTTCTA
L34MINUSR: TATGCCATTTAACATAATCATGAA
-Lr34 1170  
    cssfr3 Lr34DINT9F: TTGATGAAACCAGTTTTTTTTCTA
Lr34PLUSR: GCCATTTAACATAATCATGATGGA
csLV34F: GTTGGTTAAGACTGGTGATGG
csLV34R: TGCTTGCTATTGCTGAATAGT
+Lr34
-Lr34
517+150
229
   
    cssfr4 Lr34DINT9F: TTGATGAAACCAGTTTTTTTTCTA
Lr34MINUSR: TATGCCATTTAACATAATCATGAA
csLV34F: GTTGGTTAAGACTGGTGATGG
csLV34R: TGCTTGCTATTGCTGAATAGT
+Lr34
-Lr34
150
523+229
   
    cssfr5 Lr34DINT9F: TTGATGAAACCAGTTTTTTTTCTA
Lr34MINUSR: TATGCCATTTAACATAATCATGAA
Lr34SPF: GGGAGCATTATTTTTTTCCATCATG
Lr34DINT13R2: ACTTTCCTGAAAATAATACAAGCA
+Lr34
-Lr34
751
523
 
    cssfr6 cssfr6_f: CTGAGGCACTCTTTCCTGTACAAAG
cssfr6_r: GCATTCAATGAGCAATGGTTATC
+Lr34
-Lr34
652
649
   
    cssfr7 cssfr7_f: GCGTATTGTAATGTATCGTGAGAG
cssfr7_r: CATAGGAATTTGTGTGCTGTCC
+Lr34
-Lr34
247
214
 

References

Tommasini L, Yahiaoui N, Srichumpa P, Keller B (2006) Development of functional markers specific for seven Pm3 resistance alleles and their validation in the bread wheat gene pool. Theor Appl Genet 114:165–175. DOI:10.1007/s00122-006-0420-1

Lagudah ES, Krattinger SG, Herrera-Foessel S, Singh RP, Huerta- Espino J, Spielmeyer W, Brown-Guedira G, Selter LL, Keller B (2009) Gene-specific markers for the wheat gene Lr34/Yr18/ Pm38 which confers resistance to multiple fungal pathogens. Theor Appl Genet 119:889–898. DOI:10.1007/s00122-009-1097-z

 

Back to protocols main page