Marker Assisted Selection in Wheat - HOME USDA National Institute of Food and Agriculture The Borlaug Global Rust Initiative Marker Assisted Selection in Wheat

Functional markers for processing quality genes in wheat

Trait Locus Marker Primer sequence (5-3) Allele Expected fragment size Chromo- some Reference
Polyphenol oxidase activity
Ppo-A1 PPO18

F: AACTGCTGGCTCTTCTTCCCA
R: AAGAAGTTGCCCATGTCCGC

Ppo-A1a 685 2AL
    Ppo-A1b 876  
    PPO33 F: CCAGATACACAACTGCTGGC
R: TGATCTTGAGGTTCTCGTCG
Ppo-A1a 290  
      Ppo-A1b 481  
  Ppo-D1 PPO16 F: TGCTGACCGACCTTGACTCC
R: CTCGTCACCGTCACCCGTAT
Ppo-D1a 713 2DL
           
    PPO29 F: TGAAGCTGCCGGTCATCTAC
R: AAGTTGCCCATGTCCTCGCC
Ppo-D1b 490  
           
Lipoxygenase activity
TaLox-B1 LOX16 F: CCATGACCTGATCCTTCCCTT
R: GCGCGGATAGGGGTGGT
TaLox-B1a 489 4BS
         
    LOX18 F: ACGATGTGAGTTGTGACTTGTGA
R: GCGCGGATAGGGGTGC
TaLox-B1b 791  
           
Yellow pigment content
MASWheat link
Psy-A1 YP7A F: GGACCTTGCTGATGACCGAG
R: TGACGGTCTGAAGTGAGAATGA
PsyA1a 194 7AL
    PsyA1b 231  
  YP7A-2 F: GCCAGCCCTTCAAGGACATG
R: CAGATGTCGCCACACTGCCA
PsyA1a 1686  
    PsyA1b 1686  
        PsyA1c 1001  
  Psy-B1 YP7B-1 F: GCCACAACTTGAATGTGAAAC
R: ACTTCTTCCATTTGAACCCC
Psy-B1a 151 7BL
      Psy-B1b 156  
    YP7B-2 F: GCCACCCACTGATTACCACTA
R: CCAAGGTGAGGGTCTTCAAC
Psy-B1c 428  
           
    YP7B-3 F: GAGTAAGCCACCCACTGATT
R: TCGCTGAGGAATGTACTGAC
Psy-B1d 884  
           
    YP7B-4 F: AGGTACCAGCCAGCCCATA
R: CTCGTCAAAGTTCGTGTACC
Psy-B1e 716  
           
  Psy1-D1 YP7D-1 F: TCCGACACCATCACCAAGTTCC
R: CGTTGTAGGTTTGTGGGAGT
Psy1-D1a 1074 7DL
      Psy1-D1g 1093  
    YP7D-2 F: ACTCCCACAAACCTACAACG
R: ACGCTCATCAACCCCACG
Psy1-D1a 967  
      Psy1-D1g 1046  
  TaZds-A1 YP2A-1 F: CCCTAAGGAAGCCGAGCAAAT
R: GTGAGAGTACTAATGTTATGACCG
TaZds-A1a 183 2AL
      TaZds-A1b 179  
  TaZds-D1 YP2D-1 F: GTGGGATCCTGTTGCTTATGC
R: GTAGATTATCCAAGCCAACTGCC
TaZds-D1a   2DL
      TaZds-D1b 981  
Bread and noodle-making quality
MASWheat link
Glu-A1 UMN19 UMN19F: CGAGACAATATGAGCAGCAAG
UMN19R: CTGCCATGGAGAAGTTGGA
Ax2* 344 1AL
    Ax1 362  
      Ax-null 362  
    Ax2* F: ATGACTAAGCGGTTGGTTCTT
R: ACCTTGCTCCCCTTGTCTTT
Ax2* 1319  
           
  Glu-B1 bx7-f/r bx7-f: CACTGAGATGGCTAAGCGCC
bx7-r: GCCTTGGACGGCACCACAGG
Bx-6 321 1BL
           
    * TaBAC1215C06-F517:
ACGTGTCCAAGCTTTGGTTC
TaBAC1215C06-R964:
GATTGGTGGGTGGATACAGG
Bx7OE 447  
           
    * TaBAC1215C06-F24671: CCACTTCCAAGGTGGGACTA
TaBAC1215C06-R25515: TGCCAACACAAAAGAAGCTG
Bx7OE 844  
           
    Bx F: CGCAACAGCCAGGACAATT
R: AGAGTTCTATCACTGCCTGGT
nonBx17 630 766  
      Bx17 669  
    ZSBy8F5/R5 F: TTAGCGCTAAGTGCCGTCT
R: TTGTCCTATTTGCTGCCCTT
By8 527  
      nonBy8    
    ZSBy9aF1/R3 F: TTCTCTGCATCAGTCAGGA
R: AGAGAAGCTGTGTAATGCC
By9 662  
      nonBy9 707  
    ZSBy9F7/R6 F: TACCCAGCTTCTCAGCAG
R: TTGTCCCGACTGTTGTGG
By9    
           
    ZSBy9F2/R2 F: GCAGTACCCAGCTTCTCAA
R: CCTTGTCTTGTTTGTTGCC
By16    
      By null    
        Bx20    
  Glu-D1 UMN25 UMN25F: GGGACAATACGAGCAGCAAA
UMN25R: CTTGTTCCGGTTGTTGCCA
Dx2 299 1DL
      Dx5 281  
    Dx5 F: CGTCCCTATAAAAGCCTAGC
R: AGTATGAAACCTGCTGCGGAC
Dx5 478  
           
    * F: GCCTAGCAACCTTCACAATC
R: GAAACCTGCTGCGGACAAG
Dx5 450  
           
    UMN26 UMN26F: CGCAAGACAATATGAGCAAACT
UMN26R: TTGCCTTTGTCCTGTGTGC
Dy10 397  
      Dy12 415  
    P3 /P4 F: GTTGGCCGGTCGGCTGCCATG
R: TGGAGAAGTTGGATAGTACC
Dy10 576  
      Dy12 612  
    5+10 Dx_F:
TTTGGGGAATACCTGCACTACTAAAAAGGT
Dx5_F:
AAAAGGTATTACCCAAGTGTAACTTGTCCG
Dx_R:
AATTGTCCTGGCTGCAGCTGCGA
Glu-D1d 343  
        320  
      nonGlu-D1d 361  
  Glu-A3 gluA3a LA1F: AAACAGAATTATTAAAGCCGG
SA1R: GGTTGTTGTTGTTGCAGCA
Glu-A3a 529 1AS
           
    gluA3b LA3F: TTCAGATGCAGCCAAACAA
SA2R: GCTGTGCTTGGATGATACTCTA
Glu-A3b 894  
           
    gluA3d LA3F: TTCAGATGCAGCCAAACAA
SA4R: TGGGGTTGGGAGACACATA
Glu-A3d 967  
           
    gluA3e LA1F: AAACAGAATTATTAAAGCCGG
SA5R: GGCACAGACGAGGAAGGTT
Glu-A3e 158  
           
    gluA3f LA1F: AAACAGAATTATTAAAGCCGG
SA6R: GCTGCTGCTGCTGTGTAAA
Glu-A3f 552  
           
    gluA3g LA1F: AAACAGAATTATTAAAGCCGG
SA7R: AAACAACGGTGATCCAACTAA
Glu-A3g 1345  
           
    gluA3ac LA1F: AAACAGAATTATTAAAGCCGG
SA3R: GTGGCTGTTGTGAAAACGA
Glu-A3a 573  
      Glu-A3c    
  Glu-B3 gluB3a SB1F: CACAAGCATCAAAACCAAGA
SB1R: TGGCACACTAGTGGTGGTC
Glu-B3a 1095 1BS
           
    gluB3b SB2F: ATCAGGTGTAAAAGTGATAG
SB2R: TGCTACATCGACATATCCA
Glu-B3b 1570  
           
    gluB3c SB3F: CAAATGTTGCAGCAGAGA
SB3R: CATATCCATCGACTAAACAAA
Glu-B3c 472  
           
    gluB3d SB4F: CACCATGAAGACCTTCCTCA
SB4R: GTTGTTGCAGTAGAACTGGA
Glu-B3d 662  
           
    gluB3e SB5F: GACCTTCCTCATCTTCGCA
SB5R: GCAAGACTTTGTGGCATT
Glu-B3e 669  
           
    gluB3g SB7F: CCAAGAAATACTAGTTAACACTAGTC
SB7R: GTTGGGGTTGGGAAACA
Glu-B3g 853  
           
    gluB3h SB8F: CCACCACAACAAACATTAA
SB8R: GTGGTGGTTCTATACAACGA
Glu-B3h 1022  
           
    gluB3i SB9F: TATAGCTAGTGCAACCTACCAT
SB9R: TGGTTGTTGCGGTATAATTT
Glu-B3i 621  
           
    gluB3bef SB10F: GCATCAACAACAAATAGTACTAGAA
SB10R: GGCGGGTCACACATGACA
Glu-B3b 750  
      Glu-B3e    
        Glu-B3f    
    gluB3fg SB6F: TATAGCTAGTGCAACCTACCAT
SB6R: CAACTACTCTGCCACAACG
Glu-B3f 812  
      Glu-B3g    
Grain hardness
MASWheat link
Pin-a Pina-N2 F: TCAACATTCGTGCATCATCA
R: CTTCATTCGTCAGAGTTCCAT
Pina-D1r 436 5DS
         
  Pin-b * F: ATGAAGACCTTATTCCTCCTA
R: CTCATGCTCACAGCCGCC
Pinb-D1a 250  
           
    * F: ATGAAGACCTTATTCCTCCTA
R: CTCATGCTCACAGCCGCT
Pinb-D1b 250  
           
Starch property
MASWheat link
Wx-B1 * F: CTGGCCTGCTACCTCAAGAGCAACT
R: CTGACGTCCATGCCGTTGACGA
Wx-B1a 425 4AL
         
    Wild type BDFL: CTGGCCTGCTACCTCAAGAGCAACT
BRC1: GGTTGCGGTTGGGGTCGATGAC
Wx-B1 778  
             
    Null BFC:
CGTAGTAAGGTGCAAAAAAGTGCCACG
BRC2:
ACAGCCTTATTGTACCAAGACCCATGTGTG
Null Wx-B1 668    
             

References

Dong CH, Ma ZY, Xia XC, Zhang LP, He ZH (2012) Allelic variation at the TaZds-A1 locus on wheat chromosome 2A and development of a functional marker in common wheat. Agric Sci China (in press)

D’Ovidio R, Anderson OD (1994) PCR analysis to distinguish between alleles of a member of a multigene family correlated with wheat bread-making quality. Theor Appl Genet 88:759–763. DOI:10.1007/BF01253982

Chen F, Zhang FY, Xia XC, Dong ZD, Cui DQ (2012) Distribution of puroindoline alleles in bread wheat cultivars of the Yellow and Huai valley of China and discovery of a novel puroindoline a allele without PINA protein. Mol Breed. DOI:10.1007/s11032- 011-9553-2

Geng HW, He ZH, Zhang LP, Qu YY, Xia XC (2012) Cloning the lipoxygenase gene on chromosome 4BS and development of functional markers in common wheat. Crop Sci 52. DOI:10.2135/cropsci2011.07.0365

Giroux MJ, Morris CF (1997) A glycine to serine change in puroindoline b is associated with wheat grain hardness and low levels of starch-surface friabilin. Theor Appl Genet 95:857–864. DOI:10.1007/s001220050636

He XY, He ZH, Zhang LP, Sun DJ, Morris CF, Fuerst EP, Xia XC (2007) Allelic variation of polyphenol oxidase (PPO) genes located on chromosomes 2A and 2D and development of functional markers for the PPO genes in common wheat. Theor Appl Genet 115:47–58. DOI:10.1007/s00122-007-0539-8

He XY, Zhang YL, He ZH, Wu YP, Xiao YG, Ma CX, Xia XC (2008) Characterization of phytoene synthase 1 gene (Psy1) located on common wheat chromosome 7A and development of a functional marker. Theor Appl Genet 116:213–221. DOI:10.1007/s00122-007-0660-8

He XY, He ZH, Ma W, Appels R, Xia XC (2009a) Allelic variants of phytoene synthase 1 (Psy1) genes in Chinese and CIMMYT wheat cultivars and development of functional markers for flour colour. Mol Breed 23:553–563. DOI:10.1007/s11032-009-9255-1

Ishikawa G, Nakamura T (2007) A new co-dominant PCR-based marker to identify the high-molecular-weight glutenin subunit combination ‘‘5?10’’ of common wheat. Wheat Inf Serv 103:1–4

Lei ZS, Gale KR, He ZH, Gianibelli C, Larroque O, Xia XC, Butow BJ, Ma W (2006) Y-type gene specific markers for enhanced discrimination of high-molecular weight glutenin alleles at the Glu-B1 locus in hexaploid wheat. J Cereal Sci 43:94–101. DOI:10.1016/j.jcs.2005.08.003

Liu SX, Chao SM, Anderson JA (2008) New DNA markers for high molecular weight glutenin subunits in wheat. Theor Appl Genet 118:177–183. DOI:10.1007/s00122-008-0886-0

Ma W, Zhang W, Gale KR (2003) Multiplex-PCR typing of high molecular weight glutenin alleles in wheat. Euphytica 134:51–60. DOI:10.1023/A:1026191918704

Nakamura T, Vrinten P, Saito M, Konda M (2002) Rapid classification of partial waxy wheat using PCR-based markers. Genome 45:1150–1156. [Journal link]

Ragupathy R, Naeem HA, Reimer E, Lukow OM, Sapirstein HD, Cloutier S (2008) Evolutionary origin of the segmental duplication encompassing the wheat GLU-B1 locus encoding the overexpressed Bx7 (Bx7OE) high molecular weight glutenin subunit. Theor Appl Genet 116:283–296. DOI:10.1007/s00122-007-0666-2

Saito M, Vrinten P, Ishikawa G, Graybosch R, Nakamura T (2009) A novel codominant marker for selection of the null Wx-B1 allele in wheat breeding programs. Mol Breed 23:209–217. DOI:10.1007/s11032-008-9226-y

Smith RL, Schweder ME, Barnett RD (1994) Identification of glutenin alleles in wheat and triticale using PCR-generated DNA markers. Crop Sci 34:1373–1378. [Journal link]

Sun DJ, He ZH, Xia XC, Zhang LP, Morris CF, Appels R, Ma WJ, Wang H (2005) A novel STS marker for polyphenol oxidase activity in bread wheat. Mol Breeding 16:209–218. DOI:10.1007/s11032-005-6618-0

Schwarz G, Felsenstein FG, Wenzel G (2004) Development and validation of a PCR-based marker assay for negative selection of the HMW glutenin allele Glu-B1-1d (Bx-6) in wheat. Theor Appl Genet 109:1064–1069. DOI:10.1007/s00122-004-1718-5

Wang JW, He XY, He ZH, Wang H, Xia XC (2009a) Cloning and phylogenetic analysis of phytoene synthase 1 (Psy1) genes in common wheat and related species. Hereditas 146:208–256. DOI:10.1111/j.1601-5223.2009.02132.x

Wang LH, Zhao XL, He ZH, Ma W, Appels R, Peña RJ, Xia XC (2009b) Characterization of low-molecular-weight glutenin subunit Glu-B3 genes and development of STS markers in common wheat (Triticum aestivum L.). Theor Appl Genet 118:525–539. DOI:10.1007/s00122-008-0918-9

Wang LH, Li GY, Peña RJ, Xia XC, He ZH (2010) Development of STS markers and establishment of multiplex PCR for Glu-A3 alleles in common wheat (Triticum aestivum L.). J Cereal Sci 51:305–312. DOI:10.1016/j.jcs.2010.01.005

Zhang CY, Dong CH, He XY, Zhang LP, Xia XC, He ZH (2011) Allelic variation at the TaZds-D1 locus on wheat chromosome 2DL and their association with yellow pigment content. Crop Sci 51:1580–1590. DOI:10.2135/cropsci2010.12.0689


Back to protocols main page