Home
Protocols section

Stem rust home page

Disease resistance. Stem Rust Resistance.

QSr.abr- 7AL

Background information

Landrace PI 374670 showed resistance to several races of the Ug99 group of Puccinia graminis f. sp tritici in a field stem rust screening nursery in Njoro, Kenya. In these tests PI 374670 showed adult infection responses between resistant (R) and moderately resistant (MR) with a low disease severity (1). In seedling tests showed infection types ranging from ‘;’ to ‘;13’ to races TTKSK, MCCFC and TPMKC. PI 374670 was collected in Bosnia and Herzegovina in 1971.

This landrace does not have any of the markers linked to the six genes associated with breeding activity (the 1RS translocation, Sr24, Sr36, Sr2, Rht-B1d, and Rht-D1b) indicating that it is most likely a real landrace and not the product of modern breeding (1).

To characterize and determine the location of this resistance locus, Babiker et al. (2)  developed 216 BC1F2 families, 192 double haploid (DH) lines, and 185 recombinant inbred lines (RILs) by crossing PI 374670 and the susceptible line LMPG-6. The DH lines were tested in field stem rust nurseries in Kenya and Ethiopia and genotyped with the 90K wheat iSelect SNP genotyping platform (81,587 SNP markers, Illumina).

The seedling resistance locus of PI 374670 mapped to chromosome arm 7AL where a major QTL for field resistance was found in a 7.7 cM interval. This QTL (designated as QSr.abr- 7AL) explained 34–54 and 29–36 percent of the variation in Kenya and Ethiopia, respectively.  The mapping results were verified in the RIL population (185 lines) with a set of 11 linked and flanking SNP markers converted to KASP assays. Four of these SNPs mapped to the resistance locus and the other seven were distributed around the locus.

One additional QTL with four significant markers, designated QSr.abr-2DS, was detected on the short arm of chromosome 2D across a 32.5 cM interval using the Ethiopia data. This QTL explained 16–21 % of the phenotypic variation in Ethiopia.

KASP markers for QSr.abr- 7AL

In the PI 374670 x LMPG-6 population QSr.abr- 7AL was tightly linked to SNP marker IWB46162 (0.3 cM proximal) and 1.6, 3.8, and 7.7 cM proximal to SNP markers IWB19694, IWB27289, and IWB28967.

QSr.abr - 7AL

IWB28967

Primer name

Primer sequence

Allele

Parent

IWB28967_ALA

AAACAACGGGTTCTTGCAGAGCAT

A

PI374670

IWB28967_ALG

ACAACGGGTTCTTGCAGAGCAC

G

LMPG-6

IWB28967_C1

CGATAAAGGAGATATCTTCCTGCAAGTAT

 

 

IWAB8036

Primer name

Primer sequence

Allele

Parent

IWAB8036_ALA

ATCTCGTTTCCATTCATCTTGTACTTATA

A

PI374670

IWAB8036_ALG

CTCGTTTCCATTCATCTTGTACTTATG

G

LMPG-6

IWAB8036_C1

AGCCAGTTGCTCCCACTCTATGTTT

 

 

IWA4434

Primer name

Primer sequence

Allele

Parent

IWAB8036_ALT

GGCAGCAAGAAGAGAAAGAAAGGATT

T

LMPG-6

IWAB8036_ALC

GCAGCAAGAAGAGAAAGAAAGGATC

C

PI374670

IWAB8036_C1

CAGCGGCCTTCACCTGGGCTT

 

 

IWB46162

Primer name

Primer sequence

Allele

Parent

IWB46162_ALT

GAACTACGACAGCGTCTGGATCA

T

PI374670

IWB46162_ALC

AACTACGACAGCGTCTGGATCG

C

LMPG-6

IWB46162_C1

ATCAACCCATGCTTTTGAAGAAGGAAATTA

 

 

Sequences of the allele-specific primers do not include the tail sequences that interact with the fluor-labeled oligos in the KASP reaction mix. Only the SNPs that were significantly associated with the Ug99 resistance locus in the PI374670 x LMPG-6 populations are shown. There are other close SNP markers that could be useful in other crosses. For a complete list, the reader is referred to Babiker et al. (2).

For more information on KASP protocols, please check visit this link.


Conditions presented here should be considered only as a starting point of the PCR optimization for individual laboratories.

References

1. Field resistance to the Ug99 race group of the stem rust pathogen in spring wheat landraces. Newcomb M, Acevedo M, Bockelman HE, Brown-Guedira G, Jackson EW, Jin Y, Njau P, Rouse MN, Singh D, Wanyera R, Goates BJ, Bonman JM. In: Plant Disease, 2013, 97:882–890. DOI:10.1094/PDIS-02-12-0200-RE.

2. Mapping resistance to the Ug99 race group of the stem rust pathogen in a spring wheat landrace. Babiker EM, Gordon TC, Chao S, Newcomb M, Rouse MN, Jin Y, Wanyera R, Acevedo M, Brown Guedira G, Williamson S, Bonman JM. In: Theoretical and Applied Genetics, 2015, published online. DOI:10.1007/s00122-015-2456-6

Back to top