Marker Assisted Selection in Wheat - HOME USDA National Institute of Food and Agriculture The Borlaug Global Rust Initiative Marker Assisted Selection in Wheat

KASP assay for Soil-borne wheat mosaic virus (SBWMV) resistance gene Sbwm1 in wheat

Contributed by Shubing Liu and Guihua Bai

Background information

Soil-borne wheat mosaic virus (SBWMV) is an important pathogen in winter wheat worldwide. In the U.S. soil-borne wheat mosaic is a serious wheat disease in the Great Plains and eastern U. S. winter wheat growing regions (1). SBWMV is a member in Furovirus genus, and can be transmitted to wheat roots by the plasmodiophorid vector Polymyxa graminis to cause the disease. SBWMV-infected plants show yellow to light green leaves with dark green mottling, stunting, reduced tillers, and low kernel and test weights (2). Reported yield losses due to SBWMV infection range from 10% to 30% and was reported to be up to 80% in seriously infected fields in the U. S. and 50% in Brazil (3-5).

Sbwm1, a gene for SBWMV resistance, has been mapped on the long arm of chromosome 5D of different populations (6-8). Using association mapping with 9K Infinium iSelect Beadchips, Liu et al (9) identified two SNP markers, wsnp_CAP11_c209_198467 and wsnp_JD_c4438_5568170 that were highly associated with SBWMV resistance and mapped within 3 cM from Sbwm1 in linkage mapping.

Methods

Two KASP assays, KASPwsnp_CAP11_c209_198467 and KASPwsnp_JD_c4438_5568170, were developed for the two SNPs. PCR can be run in a regular PCR thermal cycler and PCR product can be read in a Real-Time PCR Cycler or a fluorescence scanner following manufacturer instruction (http://www.kbioscience.co.uk/reagents/KASP_manual.pdf). A pre-plate scan before PCR is required to remove background fluorescence.

KASP assay for KASPwsnp_CAP11_c209_198467:

     Forward primers: CACGCCATTAGCAGACGTACGTA -FAM
                      ACGCCATTAGCAGACGTACGTG -HEX 
     Reverse primer:  GGGGAGTTCCCGTGTATATGTAAATAAAT  

KASP assay for KASPwsnp_JD_c4438_5568170:

     Forward primers: GCCATCAGAAGTATGGGCGACT -FAM 
                      CCATCAGAAGTATGGGCGACC -HEX 
     Reverse primer:  AAATGACTGGTCATCACCTTGTATCCTT 

PCR conditions:

  • Denaturing step: 15 min at 94°C
  • Amplification step: (35 cycles)
    • 15 s at 94°C
    • 60 s at 60°C
  • 30 s at 35°C.

Expected products

The diagnostic value of the two SNP was evaluated in a set of 205 SBWMV resistant and susceptible cultivars. In KASPwsnp_CAP11_c209_198467, ‘A’ allele co-segregated with SBWMV resistance and G allele co-segregated with SBWMV susceptibility (Figure 1). In KASPwsnp_JD_c4438_5568170, ‘A’ allele present in 96.5% of the resistant and ‘G’ allele present in 95% of the susceptible accessions.

KASP marker Sbwm1
Figure 1. KASP assay for KASPwsnp_CAP11_c209_198467 in 205 wheat accessions with KASPFAM, blue color, as ‘A’ nucleotide and KASPHEX, green color, as ‘G’ nucleotide. The black dots in the circle are water controls.

Conditions presented here should be considered only as a starting point of the PCR optimization for individual laboratories.

References

1. Identification of small grains genotypes resistant to Soil-borne mosaic virus. Cadle-Davidson L, Sorrells ME, Gray SM, Bergstrom GC. In: Plant Disease, 2006, 90:1039-1044. DOI:10.1094/PD-90-1039.

2. Soilborne wheat mosaic. Koehler B, Bever WM, Bonnett OT. In: University of Illinois Agricultural Experiment Station in cooperation with U.S. Dept. of Agriculture. Bulletin, 1952, 556:565-599.

3. The effect of soil-borne wheat mosaic on yield of winter wheat. Bever WM, Pendleton JW. In: Plant Disease Report, 1954, 38:266-267.

4. Temperature-influenced virus movement in expression of resistance to Soil-borne wheat mosaic virus in hard red winter wheat (Triticum aestivum). Myers LD, Sherwood JL, Siegerist WC, Hunger RM. In: Phytopathology, 1993, 83:548–551. DOI:10.1094/Phyto-83-548.

5. Genetic control of resistance to Soil-borne wheat mosaic virus in Brazilian cultivars of Triticum aestivum L. Thell. Barbosa M,  Goulart L,  Prestes A, Juliatti F. In: Euphytica, 2001, 122: 417–422. DOI:10.1023/A:1012937116394.

6. A conserved locus conditioning Soilborne wheat mosaic virus resistance on the long arm of chromosome 5D in common wheat. Hao Y, Wang Y, Chen Z, Bland D, Li S, Brown-Guedira G, Johnson J. In: Molecular Breeding, 2012, 30:1453–1464. DOI:10.1007/s11032-012-9731-x.

7. Advanced backcross QTL analysis of a hard winter wheat x synthetic wheat population. Narasimhamoorthy B, Gill BS, Fritz AK, Nelson JC, Brown-Guedira GL. In: Theoretical and Applied Genetics, 2006, 112:787-796. DOI:10.1007/s00122-005-0159-0.

8. Genetic analysis of resistance to Soil-borne wheat mosaic virus derived from Aegilops tauschii. Hall MD, Brown-Guedira G, Klatt A, Fritz AK. In: Euphytica, 2009, 169:169–176. DOI:10.1007/s10681-009-9910-y.

9. Liu S, Yang X, Zhang D, Chao S, Bockus W, Bai G. Genome-wide association analysis identified SNPs closely linked to a gene resistant to Soil-borne wheat mosaic virus. In: Theoretical and Applied Genetics (2014, accepted).

Back to top