Home
Protocols section

Stem rust home page

Disease resistance. Stem Rust Resistance.

Sr13

Contributed by W. Zhang, J. Dubcovsky

Marker for Sr13

Sr13 is a stem rust resistance gene present in several Triticum turgidum ssp. durum cultivars. Its main sources are the Ethiopian land race ST464 and the T. turgidum ssp. dicoccon L. (emmer wheat) germplasm Khapli (1,2). The location of Sr13 in tetraploid wheat cultivars is on the long arm of chromosome 6A, within a 1.2 to 2.8 cM interval, depending on the mapping population, flanked by EST-derived markers CD926040 and BE471213 (3). Sr13 is the only known gene effective against the TTKS complex of Puccinia graminis sp. tritici: the TTKSK (Ug99) race and its variants, TTKST and TTTSK. Currently this gene is the only one effective against the TTKS complex within the US durum wheat adapted cultivars, it is present in some common durum cultivars like Kofa, Kronos, Langdon, Medora and Sceptre. Sr13 is especially frequent in germplasm originated in durum breeding programs from North Dakota. This gene confers a moderate type of resistance, so it is recommended to deploy this gene pyramided with other resistance genes, which will also extend the durability of the individual genes. Despite being a frequent gene in durum lines, Sr13 has had a more restricted use in common wheat lines in the US, in contrast to its more extensive use in Australian hexaploid germplasm.

Simons et al. (3) constructed four mapping populations to precisely map Sr13 and to find molecular markers useful for breeding. These authors found that Sr13 is closely linked to several polymorphic molecular markers but they have different alleles for each donor, suggesting that the breeding programs historically used different sources of Sr13 or that independent recombination events occurred between loci. Taking together the data from the four mapping populations, the closer common markers are Xgwm427 and Xwmc580. However, considering each population separately, it is possible to find better markers. For example EST-derived marker BE403950 was completely linked to Sr13 in a Mindum x Medora population.

Table 1 below contains the information for several PCR markers (SSR and EST-derived) that map close to Sr13. The band sizes of the marker alleles vary with the donor parent considered. Also the alleles in the non-Sr13 susceptible lines are variable. Note that the current markers are not diagnostic in all the genetic backgrounds and, therefore, they cannot be used to predict the presence of Sr13 in an unknown set of germplasm. These markers can be used to follow the Sr13 resistant alleles in segregating populations including some of the parental lines with any of the known Sr13 sources indicated above. The alleles associated with Sr13 from each marker and each genetic background is summarized in Table 2. Users are advised to carefully check the alleles present in the Sr13 and non-Sr13 parents of their breeding lines before routine application.

Marker Type Primer sequences Notes
Xbarc104b SSR BARC104b-F GCGCTTCCAAGGCTTAGAGGCT
BARC104b-R GGACCAGGCATGTCTACCCT
Annealing temp.: 50°C
Xbarc104c SSR BARC104c-F GCATGTTTCCCATCCCTTTA
BARC104c-R GCCTTCCTCCCTTTTGAAAC
Annealing temp.: 50°C
Xwmc580 SSR WMC580-F AAGGCGCACAACACAATGAC
WMC580-R GGTCTTTTGTGCAGTGAACTGAAG
Annealing temp.: 60°C
Xdupw167 SSR dupw167-F CGGAGCAAGGACGATAGG
dupw167-R CACCACACCAATCAGGAACC
Annealing temp.: 54°C
XCK207347 EST CK207347-F TTACGGGCCACAAACAATCT
CK207347-R AGCTCTCATCCATCCAGGAA
Touch down from 60°C to 55°C
XCD926040 EST CD926040-F GTTGGCTTGGCTACTGCTTT
CD926040-R AGCATTCAGCTCTGTGAGCA
Touch down from 60°C to 55°C
XBE403950 EST BE403950-F GGAACATGTTGACGCTGTTG
BE403950-R AACACTGTTCCCGAAGTTGG
Touch down from 60°C to 55°C
Table 1. Primers and PCR conditions for markers associated with Sr13


Accession

Origin

wmc580
CK207347
CD926040
BE403950
dupw167
TTKSK

Sr13 present

 

 

 

 

 

 

 

Khapli (CItr4013)

NSGCa

293

1000

851

691

230

;2-

W2691Sr13

NSGCa

326

1000

851

691

245

2

Langdon

ND

293

1000

-

691

249

2

Kofa

WestBred

293

1000

855

723

230

2

Kronos

AZ Pl. Breed.

293

1135

855

-

245

2+

Medora

Canada

317

1000

855

723

230

2

Sceptre

Canada

317

1000

855

723

230

2

ST464-C1

ND

293

1000

-

691

249

2+

Sr13 absent

 

 

 

 

 

 

 

Rusty

ND

293

993

845

-

230

4

Mindum

MN

335

1135

851

691

230

4

UC1113

CA

317

1000

855

723

249

4

Table 2 Allele sizes for different markers in different germplasm known to carry Sr13. The markers are not diagnostic and should be used in populations with known resistance sources.
a: NSGC – USDA-ARS, National Small Grains Collection, Aberdeen, ID.

barc_104b
Alleles of Xbarc104b. 1. Khapstein; 2. Khapstein/9*LMPG-6 ; 3. LMPG-6; 4. Khapli; 5. Kofa; 6. Kronos; 7. Rusty; 8. Mindum; 9. Medora; 10. Sceptre. R and S denote resistance and susceptibility to TTKSK, respectively. Underlined R indicates a known carrier of Sr13. Arrows indicate Sr13 resistant genotypes with the same barc104b allele as Khapli.

Sr13_map
Partial view of the genetic maps presented in ref. 3. Markers with an asterisk were mapped at LOD scored lower than 2.0. Markers barc104b and barc104c refer to the same locus, but they were amplified with different primer pairs optimized to detect polymorphisms in the different genetic backgrounds (see table of markers).

Conditions presented here should be considered only as a starting point of the PCR optimization for individual laboratories.

References

1. The inheritance of rust resistance:  IX. The inheritance of resistance to races 15B and 56 of stem rust in the wheat variety Khapstein. Knott DR. In: Canadian Journal of Plant Sciences, 1962, 42:415-419.

2. Chromosomal locations of genes for stem rust resistance in monogenic lines derived from tetraploid wheat accession ST464. Klindworth DL, Miller JD, Jin Y, Xu SS. In: Crop Science, 2007, 47:1441-1450. DOI:10.2135/cropsci2006.05.0345.

3. Genetic mapping of stem rust resistance gene Sr13 in tetraploid wheat (Triticum turgidum ssp. durum L.). Simons K, Abate Z, Chao S, Zhang W, Rouse M, Jin Y, Elias E, Dubcovsky J. In: TAG Theoretical and Applied Genetics, 2011, 122:649-658. DOI: 10.1007/s00122-010-1444-0

Back to top