Home
Protocols section

Stem rust home page

Disease resistance. Stem Rust Resistance.

Sr35

Contributed by W. Zhang, M. Pumphrey and J. Dubcovsky

Markers for Sr35 Sr35_map

The stem rust resistance gene Sr35 was originally transferred from Triticum monococcum to hexaploid wheat (1) and is effective against the TTKSK (Ug99) race of of Puccinia graminis sp. tritici (2) and its variants, TTKST and TTTSK. During the field tests in Kenya in 2005 and 2006 this gene showed resistant to moderately resistant infections responses with relatively low disease severity (2). Using two T. monococcum mapping populations it was shown that Sr35 maps on the long arm of chromosome 3Am between markers XBF483299 and XCJ656351 in a region of 2.2 to 3.1 cM, depending on the population (3). Additionally, crossing the hexaploid line Marquis*5/G2919 (a T. monococcum accession carrying Sr35) to two susceptible hexaploid cultivars, it was confirmed that the T. monococcum fragment containing Sr35 is located on chromosome arm 3AL in T. aestivum. Because of its alien origin this fragment has none or very low recombination with the T. aestivum chomosomes, reducing the genetic distances. For example, the distance between marker Xbarc69, outside the fragment on the proximal side, and Xgwm480, the most distal marker within the fragment is 42 cM in the T. aestivum consensus map while the distance decreases to 2.2 cM - 4.1 cM in maps generated from crosses between Marquis*5/G2919 and T. aestivum (3).

Saintenac et al. (4) cloned the Sr35 gene from T. monococcum and showed it codes for a coiled coil-nucleotide binding-leucine rich repeat product (CNL). The Sr35 was found in a region containing five intact genes coding for the same type of proteins (CNL1, CNL2, CNL4, CNL6 and CNL9). Analyzing mutants induced by ethyl-methanesulfonate, the natural variation in a number of accessions and transgenic plants the authors could demonstrate that CNL9 is Sr35. CNL proteins are involved in the detection of pathogen attacks of different types.

A number of polymorphic SSR and EST-derived markers were found on the T. monococcum fragment containing Sr35 and transferred to hexaploid wheat. They are shown in the blue box in the map on the right. Since this fragment has reduced recombination in hexaploid wheat, all the markers in the Table are useful for marker assisted selection. Still, it is better to use the closest polymorphic marker to Sr35 to reduce the risk of occasional recombination, and to check the final material with a second marker on the other side of Sr35.

Marker
Type
Primer sequences Notes Band size
(Marquis Sr35 / Marquis)
Xcfa2193
SSR
CFA2193-F ACATGTGATGTGCGGTCATT
CFA2193-R TCCTCAGAACCCCATTCTTG
Anneal. temp.: 60°C
243 / 230
XBE423242
Indel
BE424242-F TCTGACCAATGCAAAATGGA
BE424242-R GCTGATTGGCTTGGAAGGTA
Touch down from 63°C to 59°C (9 cycles of 20 sec, -0.5°C each)
Amplification at 58°C (34 cycles of 20 sec each)
430 / 426
Xwmc559
SSR
WMC559-F ACACCACGAATGATGTGCCA
WMC559-R ACGACGCCATGTATGCAGAA
Anneal. temp.: 61°C
~225 / 235
XBF485004
Indel
BE485004-F TGCAGAATGCGTTCCTTCTA
BE485004-R GGCCAGAGAATTTCTTGAGG
Touch down from 63°C to 59°C (9 cycles of 20 sec, -0.5°C each)
Amplification at 58°C (34 cycles of 20 sec each)
Null / 597
Xcfa2170
SSR
CFA2170-F TGGCAAGTAACATGAACGGA
CFA2170-R ATGTCATTCATGTTGCCCCT
Anneal. temp.: 60°C
~180 / 190
XAK335187
InDel
AK335187-F GGTTCAACATCGTCGGACAG
AK335187-R CCAGCACGACGTACTTGGAG
Anneal. temp.: 58°C
~205 / 205, 290
Xcfa2076
SSR
CFA2076-F CGAAAAACCATGATCGACAG
CFA2076-R ACCTGTCCAGCTAGCCTCCA
Anneal. temp.: 60°C
~180 / 182
XBE405552
Indel
BE405552-F CACCATCTTCGTCACCATCA
BE405552-R CACAGTGCAGCGAACAGAT
Touch down from 63°C to 59°C (9 cycles of 20 sec, -0.5°C each)
Amplification at 58°C (34 cycles of 20 sec each)
377 / 371
Xwmc169
SSR
WMC169-F TACCCGAATCTGGAAAATCAAT
WMC169-R TGGAAGCTTGCTAACTTTGGAG
Anneal. temp.: 61°C
143 / 153
Xgwm480
SSR
GWM480-F TGCTGCTACTTGTACAGAGGAC
GWM480-R CCGAATTGTCCGCCATAG
Anneal. temp.: 60°C
null / 188

Conditions presented here should be considered only as a starting point of the PCR optimization for individual laboratories.

References

1. Cytogenetical studies in wheat .XIII. Sr35 - a 3rd Gene from Triticum monococcum for resistance to Puccinia graminis tritici. McIntosh RA, Dyck PL, The TT, Cusick J, Milne DL. In: Zeitschrift für Pflazenzüchtung, 1984, 92:1-14.

2. Characterization of seedling infection types and adult plant infection responses of monogenic Sr gene lines to race TTKS of Puccinia graminis f. sp tritici. Jin Y, Singh RP, Ward RW, Wanyera R, Kinyua M, Njau P, Pretorius ZA. Plant Disease, 2007, 91:1096-1099. DOI:10.1094/PDIS-91-9-1096.

3. Genetic maps of stem rust resistance gene Sr35 in diploid and hexaploid wheat. Zhang W, Olson E, Saintenac C, Rouse M, Abate Z, Jin Y, Akhunov E, Pumphrey M, Dubcovsky J. In: Crop Science, 2010, 50: 2464-2474. DOI:10.2135/cropsci2010.04.0202

4. Identification of wheat gene Sr35 that confers resistance to Ug99 stem rust race group. Saintenac C, Zhang W, Salcedo A, Rouse MN, Trick HN, Akhunov E, Dubcovsky J.In: Science, published online 27 June 2013. DOI:10.1126/science.1239022.



[Back to top]