Marker Assisted Selection in Wheat - HOME USDA National Institute of Food and Agriculture The Borlaug Global Rust Initiative Marker Assisted Selection in Wheat

Disease resistance. Stem Rust Resistance.

Sr47

Contributed by Daryl Klindworth and Steven Xu

The stem rust resistance gene Sr47 was transferred from Aegilops speltoides (PI 369590) through ph1b-induced homeologous recombination to a durum wheat background resulting in line DAS15. The introgression is located on a T2BL-2SL·2SS chromosome in which the 2BL telomere comprised less than 10% of the long arm (1).  Klindworth et al. (2) recovered short allosyndetic recombinants of DAS15 with Rusty durum (PI 639869), and found that the Ae. speltoides segment actually carried two stem rust resistance genes, one of which may be identical to Sr39.  The second gene, which conditioned an infection type (IT) 0; phenotype to stem rust, was located on chromosome arm 2SL and may be homoeoallelic to Sr9.  This IT 0; gene has been assigned the Sr47 gene symbol.  Even if Sr47 is shown to be allelic to Sr9, its phenotype and reaction to a diverse set of stem rust races, including TTKSK (Ug99), indicates that it is different from any other Sr9 allele.

Markers for Sr47

Three of the allosyndetic recombinants developed by Klindworth et al. (2) are provided for breeding (RWG35, RWG36, and RWG37). The authors observed segregation distortion, resulting in preferential transmission of Sr47 in two of the three recombinants.  Each recombinant carries Sr47 on short Ae. speltoides segments that have slightly different translocation points, and hence require different SSR markers.  In RWG35, the speltoides segment carrying Xgpw4043 has been replaced by wheat chromatin.  To make selections in RWG35, it is necessary to use marker Xgwm501 combined with either Xgwm47 or Xgpw4165.  Of the markers listed below, Xgpw4043 is co-dominant, while Xgwm501 is dominant and linked in coupling phase.  All other markers are dominant and linked in repulsion phase.  Because it is co-dominant, Xgpw4043 is the preferred marker. 

Any of the markers listed in Table 1 and Figure 5 from Reference 2 (open content) can be used for selection; however, we list here only the four that may be most useful. Please note that alternative names are used for the recombinant lines: 0406 (RWG35), 0696 (RWG36) and 0717 (RWG37). Primer sequences and amplification conditions for the other markers can be found on GrainGenes.

Table 1.   Haplotypes for seven SSR markers in three Ti2BL-2SL-2BL·2BS allosyndetic recombinants carrying Sr47.

Line (family)

Xgpw4043

Xwmc 627

Xwmc332

Xgpw165

Xgwm47

Xgwm501

Xgpw4112

RWG 35 (0406)

W

W

W

S

S

S

S

RWG 36 (0696)

S

S

S

S

S

S

S

RWG 37 (0717)

S

S

S

S

S

W

W

Markers are listed in order from most distal (left) to most proximal (right). W= wheat allele; S =Ae. speltoides allele.  Only markers detecting the speltoides segment can be used in each RWG line.

Primers sequences:

Xgpw4043

   gpw4043-F     5'- ACATATGCACGCACGCAC -3' 
   gpw4043-R     5'- CATTGACACCCCTGACACTC -3' 

Xgwm501

   gwm501-F     5'- GGCTATCTCTGGCGCTAAAA -3' 
   gwm501-R     5'- TCCACAAACAAGTAGCGCC -3' 

Xgwm47

   gwm47-F      5'- TTGCTACCATGCATGACCAT -3' 
   gwm47-R      5'- TTCACCTCGATTGAGGTCCT -3' 

Xgpw4165

   gpw4165-F    5'- GGATTCCAACAGAGCACCTT -3' 
   gpw4165-R    5'- AAGCAAGAAACAATGGGCAC -3' 
PCR conditions:
  • Denaturing step: 94°C, 3 min
  • Touchdown step 1 (0.5 ºC down each cycle until final annealing temeprature):
    • 94°C, 30 sec
    • Final annealing temperature + 5°C, 30 sec
    • 72°C, 2 min
  • Amplification step (30 cycles):
    • 94°C, 30 sec
    • Final anneling temeprature, 30 sec
    • 72°C, 2 min
  • Extension step: 72°C, 10 min

Final annealing temperatures were: 58°C for Xgwm501 and Xgwm47, and 60°C for Xgpw4043 and Xgpw4165.

Researchers should note that for markers Xgwm501 and Xgwm47, the polymorphism is due to allele drop out.  For example, in Xgwm501 an intense 109 bp band indicates the presence of the Ae. speltoides chromatin, while the wheat segment may produce either a null or a less intensely stained 109 bp band (Note Rusty and Rusty 2D(2B) in Figure S5 of Ref. 2).  We have found that PCR conditions which increase marker specificity, such as lowering Mg concentration, can eliminate or reduce this problem.  Therefore, researchers need to optimize PCR conditions of these markers for their situation.

Expected products:

For PAGE separation, PCR were run on 8% acrylamide 10-cm mini-gels. Electrophoresis was conducted at 150 V for 40 min if expected products were less than 150 bp. For larger products the run time was extended to 50-55 min. Figure 5S and Figure 5 of Ref. 2 (open content) show the results for the recombinant lines and a validation panel respectively.

Conditions presented here should be considered only as a starting point of the PCR optimization for individual laboratories.

References

1. Molecular and cytogenetic characterization of a durum wheat-Aegilops speltoides chromosome translocation conferring resistance to stem rust. Faris JD, Xu SS, Cai X, Friesen TL, Jin Y. In: Chromosome Research, 2008, 16:1097-1105.
DOI:10.1007/s10577-008-1261-3.

2.Introgression and Characterization of a Goatgrass Gene for a High Level of Resistance to Ug99 Stem Rust in Tetraploid Wheat. Klindworth DL, Niu Z, Chao S, Friesen TL, Faris JD, Cai X, Xu SS. In: Genes, Genomes, Genetics, 2012,  2:665-673.
DOI:10.1534/g3.112.002386

Back to top