Marker Assisted Selection in Wheat - HOME USDA National Institute of Food and Agriculture The Borlaug Global Rust Initiative Marker Assisted Selection in Wheat

KASP Marker for causal SNPs in PHS resistance gene TaPHS1

Contributed by Shubing Liu and Guihua Bai

Background information

Pre-harvest sprouting (PHS) in wheat (physiologically mature grains germinating in spikes before harvest) causes significant losses in grain yield and quality, particularly in the regions with prolonged wet weather during a harvest season. Direct annual losses caused by PHS approach US$ 1 billion worldwide (1).

Resistance to PHS in wheat is a complex trait that is affected by both genotype and environment (2). Quantitative trait loci (QTLs) for PHS resistance have been reported on most wheat chromosomes (2-7). A major QTL for PHS resistance was mapped on 3AS (8) and recently the gene, designated as TaPHS1, underlying this QTL was cloned using map-based cloning (9).

We identified two key mutations in the coding region of the gene that are responsible for the change in PHS susceptibility, One is a GT-to-AT transition at the 5’ donor splice-site of the intron 3, which extends the exon 3 into intron 3 and the other is an A-to-T transversion that generates a premature stop codon and result in a truncated protein in susceptible genotypes (106 amino acids). Two KASP assays were developed to diagnose these two mutations in TaPHS1.

Methods

Two KASP assays were designed: KASPTaPHS1-646 for the mis-splicing site and KASPTaPHS1-666 for the premature stop codon. PCR can be run in a regular PCR thermal cycler and PCR product can be read in a Real-Time PCR Cycler or a fluorescence scanner following manufacturer instruction (http://www.kbioscience.co.uk/reagents/KASP_manual.pdf). A pre-plate scan before PCR is required to remove background fluorescence.

KASP assay for KASPTaPHS1-646:

     Forward primers: GGTGGAACAGATGCAACTAAAGG -FAM
                      GGTGGAACAGATGCAACTAAAGA -HEX 
     Reverse primer:  GTGAGTGTTATATGAAACTAATGATCCATT 

KASP assay for KASPTaPHS1-666:

     Forward primers: GTGAGTGTTATATGAAACTAATGATCCATTT -FAM 
                      GTGAGTGTTATATGAAACTAATGATCCATTA -HEX 
     Reverse primer:  ACCGGGTGGAACAGATGCAACTAAA 

PCR conditions:

  • Denaturing step: 15 min at 94°C
  • Amplification step: (35 cycles)
    • 15 s at 94°C
    • 60 s at 60°C
  • 30 s at 35°C.

Expected products

The diagnostic value of the two SNP was evaluated in a set of 82 wheat PHS resistant and susceptible cultivars. In KASPTaPHS1-646, ‘G’ allele co-segregated with PHS resistance and “A” allele co-segregated with PHS susceptibility (Figure. 1). In KASPTaPHS1-666, ‘A’ allele present in the resistant accessions and ‘T’ allele present in the susceptible accessions.

KASP marker TaPHS1
Figure 1.A KASP assay for SNP KASPTaPHS1-646 analyzed using 82 wheat accessions. Blue color is KASPFAM showing genotypes ‘G’ nucleotide and green color is KASPHEX showing genotypes with ‘A’ nucleotide. The black dots and x in the rectangle are water and blank controls.

Conditions presented here should be considered only as a starting point of the PCR optimization for individual laboratories.

References

1. The encyclopedia of seeds science, technology and uses. Black M, Bewley JD, Halmer P, 2006. CABI Publishing, Wallingford, Oxfordshire, pp 528.

2. Characterization of quantitative trait loci controlling genetic variation for preharvest sprouting in synthetic backcross-derived wheat lines. Imtiaz M, Ogbonnaya FC, Oman J, Ginkel M. In: Genetics, 2008, 178: 1725-1736.
DOI:10.1534/genetics.107.084939.

3. Study of the relationship between pre- harvest sprouting and grain color by quantitative trait loci analysis in a white - red grain bread wheat cross. Groos C, Gay G, Perretant MR, Gervais L, Bernard M et al. Theoretical and Applied Genetics, 2002, 104: 39-47. DOI:10.1007/s00122-005-0065-5.

4. Association mapping for pre-harvest sprouting resistance in white winter wheat. Kulwal, P, G. Ishikawa, D. David-Benscher, Z. Feng, L. X. Yu, A. Jadhav, S. Mehetre, M. E. Sorrells. In: Theoretical and Applied Genetics, 2012, 125:793-805. DOI:10.1007/s00122-012-1872-0.

5. Mapping QTLs for grain dormancy on wheat chromosome 3A and group 4 chromosomes, and their combined effect. Mori M, Uchino N, Chono M, Kato K, Miura H. In: Theoretical and Applied Genetics, 2005, 110: 1315-1323. DOI:10.1007/s00122-005-1972-1.

6. A QTL located on chromosome 4A associated with dormancy in white- and red-grained wheats of diverse origin. Mares D, Mrva K, Cheong J, Williams K, Watson B, et al. In: Theoretical and Applied Genetics, 2005, 111: 1357-1364.
DOI:10.1007/s00122-005-0065-5.

7. Mapping quantitative trait loci for preharvest sprouting resistance in white wheat. Munkvold JD, Tanaka J, Benscher D, Sorrells ME. In: Theoretical and Applied Genetics, 2009, 119: 1223-1235. DOI:10.1007/s00122-009-1123-1.

8. Quantitative trait loci for resistance to pre-harvest sprouting in U.S. hard white winter wheat Rio Blanco. Liu S, Cai S, Graybosch R, Chen C, Bai G. In: Theorical and Applied Genetics, 2008, 117: 691-699.  DOI:10.1007/s00122-008-0810-7.

9. Cloning and Characterization of a critical regulator for pre-harvest sprouting in wheat. Liu S, Sehgal SK, Li J, Lin M, Trick HN, Yu J, Gill BS, Bai G. In: Genetics, 2013, 195:263-273. DOI:10.1534/genetics.113.152330.

Back to top