Home
Protocols section

Disease resistance. Stripe Rust Resistance.

Yr60

Background information

The hexaploid wheat line “Almop” showed moderate resistance to stripe rust in field test performed in México. The predigree of this line include a chromosome 1B monosomic line of “Lalbahadur” which was developed at CIMMYT for mapping the Lr46/Yr29 loci. Some of the lines produced for this mapping project lacked Lr46/Yr29 but carried a gene, later designated Yr60, which conferred moderate resistance to stripe rust. The source of this resistance was present in the monosomic line but did not probably originate in “Lalbahadur” itself (1,2).

Herrera-Foessel et al. (2) developed a mapping population of 148 F5 RILs from the susceptible parent “Avocet” and the line “Almop” that carries Yr60 to determine the chromosomal position of this gene using molecular markers. This gene confers moderate resistance at both, the seedling and the adult plant stages against the two Mexican races of Puccinia striiformis f. sp. tritici. In the adult plant resistance tests the “Almop” showed disease severities that varied from 20 to 50%, in contrast to the 90-100% stripe rust severity displayed by the susceptible parent “Avocet”. In the seedling tests “Almop” displayed a moderately resistant infection type of 5-6, and Avocet, 7-8.

Markers for Yr60

Yr60 maps on the distal end of chromosome arm 4AL, co-segregating with wmc776. Other markers that can be useful in MAS programs are wmc313 and wmc219, which are located 0.6 cM distal to Yr60.

Primer sequences:

wmc776

    WMC776-F  5-  CCA TGA CGT GAC AAC GCA G -3
    WMC776-R  5-  ATT GCA GGC GCG TTG GTA -3 

    Annealing temperature: 61 °C  

wmc313

    WMC313-F  5- GCA GTC TAA TTA TCT GCT GGC G  -3
    WMC313-R  5- GGG TCC TTG TCT ACT CAT GTC T  -3

    Annealing temperature: 51 °C

wmc219

    WMC219-F  5- TGC TAG TTT GTC ATC CGG GCG A -3
    WMC219-R  5- CAATCCCGTTCTACAAGTTCCA -3
    
	Annealing temperature: 61 °C

Conditions presented here should be considered only as a starting point of the PCR optimization for individual laboratories.

References

1. Molecular marker mapping of leaf rust resistance gene Lr46 and its association with stripe rust resistance gene Yr29 in wheat. William M, Singh RP, Huerta-Espino J, Ortiz Islas S, Hoisington, D. In: Phytopathology, 2003, 93:153-159.
DOI:10.1094/PHYTO.2003.93.2.153.

2. Yr60, a gene conferring moderate resistance to stripe rust in wheat. Herrera-Foessel SA., Singh RP, Lan CX, Huerta-Espino J, Calvo-Salazar V, Bansal UK, Bariana HS, Lagudah ES. In: Plant Disease, 2015, 99:508-511. 10.1094/PDIS-08-14-0796-RE.

Back to top