Home
Protocols section

Disease resistance. Eyespot resistance.

Pch2

Adam Heesacker, Hilary Gunn, Chris Mundt, and Robert Zemetra

Eyespot is a disease caused by the fungal pathogens Oculimacula acuformis and O. yallundae (1) and causes lower stem lesions and lodging of wheat plants, leading to reduced yield and lower end-use quality.  The best form of control for this soil-based pathogen is to plant resistant cultivars.  There are two main genes for resistance to eyespot, Pch1 (2) and Pch2 (3) and one QTL (4) identified in the literature, though others have recently been suggested based on association mapping (5).  The strongest resistance comes from Pch1, which was transferred to wheat from the wild relative Aegilops ventricosa to the distal portion of the long arm of chromosome 7D in the variety VPM.  Pch2 is derived from the cultivar Cappelle Desprez and, though on the related chromosome arm 7AL and in a collinear location to Pch1 (6), on further review seems to not be an ortholog of Pch1 due to gene order genetic mapping by comparison to Brachypodium distachyon (7).  Pch2, while having less genetic resistance effect than Pch1, is still very useful in combination with Pch1 leading to much less disease in high infection environments (8).

With the recent publication of the annotated wheat genome derived from the cultivar Chinese Spring (9), a new resource has become available for looking at the genetic region of Pch2 in closer detail (https://urgi.versailles.inra.fr/jbrowseiwgsc/gmod_jbrowse/).  Pasquariello et al. (7) located Pch2 as being between the gene orthologous to Bradi1g30210 and the SSR marker wmc525 (which had been used by Oregon State University’s wheat breeding program to transfer Pch2 with success).

A search for the ortholog of Bradi1g30210 came up with TraesCS7A02G331700, which is close to the centromere on the long arm of chromosome 7A.  Knowing that Opata85 carries Pch2 while Chinese Spring does not, (based on the wheat pedigree database (http://genbank.vurv.cz/wheat/pedigree/), we were able to look at the haplotypes and functions of the genes within the region bordered by these two loci. 

Travelling centromerically from the marker wmc525 a giant cluster of NB-LRR type resistance genes is encountered spanning almost a megabase (712178569 to 713136864) that differ between Chinese Spring and Opata85 for haplotype. The genes TraesCS7A02G533800, TraesCS7A02G534900, TraesCS7A02G535100, TraesCS7A02G535400, TraesCS7A02G763600LC, and TraesCS7A02G535500 all carry either the LRR or NB-ARC domains, and upon closer inspection of the sequences of TraesCS7A02G535100, appear to be a condensation of a gene family of paralogs (a case previously seen in sunflower when investigating the Pl1 locus (10). Because we had no differentials to dissect this gene cluster and determine which gene is actually Pch2, markers (centromeric and distal) were designed to gene sequences flanking this cluster. Design for a more centromeric marker failed, so the best centromeric marker to use is the KASP marker XBS1_30210 from Pasquariello et al. (7). The KASP marker given here (Table1 and Figure 1) uses the polymorphism of the MEMO-like protein TraesCS7A02G536200 which gets ~128,000 base pairs closer to Pch2 than the previous marker wmc525.

If you use this marker to develop a cultivar, please cite this web page and Adam Heesacker, Hilary Gunn, Chris Mundt, and Robert Zemetra as webpage authors in your cultivar release.

Table 1. Primers for Pch2 KASP marker

Pch2_14-4 Pch2_14-4-C Pch2 CTATGATCTCCATGCCCAAC
  Pch2_14-4-G pch2 CTATGATCTCCATGCCCAAG
  Pch2_14-4-R2   TCGCTTGGGCATCAGGTAT

Figure 1. Allele discrimination plot of the KASP marker

Pch2 KASP marker

Conditions presented here should be considered only as a starting point of the PCR optimization for individual laboratories.

References

1. Eyespot of cereals revisited: ITS phylogeny reveals new species relationships. Crous PW, Groenewald JZE, Gams W. In: European Journal of Plant Patholology, 2003, 109:841-850. DOI: 10.1023/A:1026111030426.

2. Identification of a candidate gene for the wheat endopeptidase Ep-D1 locus and two other STS markers linked to the eyespot resistance gene. Leonard JM, Watson CJW, Carter AH, Hansen JL, Zemetra RS, Santra DK, Campbell KG, Riera-Lizarazu O. in: Theoretical and Applied Genetics, 2008, 116:261-270. DOI: 10.1007/s00122-007-0664-4.

3. The development of PCR-based markers for the selection of eyespot resistance genes Pch1 and Pch2. Chapman NH, Burt C, Dong H, Nicholson P. Theoretical and Applied Genetics, 2008, 117:425-433. DOI: 1007/s00122-008-0786-3.

4. Identification of a QTL conferring seedling and adult plant resistance to eyespot on chromosome 5A of Cappelle Desprez. Burt C, Hollins TW, Nicholson P. Theoretical and Applied Genetics, 2011, 122:119-128. DOI: 1007/s00122-010-1427-1.

5. Genomewide association mapping for eyespot disease in US Pacific Northwest winter wheat. Lewien MJ, Murray TD, Jernigan KL, Garland-Campbell KA, Carter AH. In: PLoS ONE, 2018, 13 (4): e0194698. DOI: 1371/journal.pone.0194698.

6. Exploiting co-linearity among grass species to map the Aegilops ventricosa-derived Pch1 eyespot resistance in wheat and establish its relationship to Pch2. Burt C, Nicholson P. In: Theoretical and Applied Genetics, 2011, 123:1387-1400. DOI: 1007/s00122-011-1674-9.

7. The eyespot resistance genes Pch1 and Pch2 of wheat are not homoeoloci. Pasquariello M, Ham J, Burt C, Jahier J, Paillard S, Uauy C, Nicholson P. Theoretical and Applied Genetics, 2017, 130:91-107. DOI: 1007/s00122-016-2796-x.

8. Pyramiding for resistance durability: Theory and practice. Mundt CC. In: Phytopathology, 2018, 108:792-802. DOI: 1094/PHYTO-12-17-0426-RVW.

9. Shifting the limits in wheat research and breeding using a fully annotated reference genome. International Wheat Genome Sequencing Consortium IWGSC. In: Science, 2018, 361 (6403) 661-674. DOI: 1126/science.aar7191.

10. Haplotyping and Mapping a Large Cluster of Downy Mildew Resistance Gene Candidates in Sunflower Using Multilocus Intron Fragment Length Polymorphisms. Slabaugh, MB, Yu JK, Tang SX, Heesacker AF, Hu X, Lu GH, Bidney D, Han F, Knapp SJ Plant Biotechnology Journal, 2003, 1:167-185. DOI: 1046/j.1467-7652.2003.00016.x.

Back to top