Protocols section
Stem rust home page

Disease resistance. Stem Rust Resistance.

Sr12

Background information

“Thatcher” is a hard red spring wheat cultivar developed in Minnesota and released in 1935 specifically for stem rust resistance.  It was the dominant cultivar in the Northern Great Plains of the United States and the Canadian Prairies for several decades until the mid-1960s. Furthermore, it was widely used as a stem rust resistant donor in breeding programs in the US and Canada.

Sr12 is one of the many stem rust resistance loci found in Thatcher (1). It was first described as a seedling stage resistance gene located on the short arm of chromosome 3B or on the long arm close to the centromere (2). The seedling stage resistance that carries Thatcher, including Sr12, was shown to be ineffective against Ug99 and its variants in field tests in Kenya.  However, Thatcher did show some level of adult plant resistance (APR) against those same races (3), something that had already been observed for some North American races.

Vanegas et al. (4) discovered evidence that a resistance QTL on 2BL might be involved in the APR phenotype. They also found that both, seedling stage resistance and APR, were enhanced by the multi-pathogen resistance gene Lr34/Sr57.  Later, Rouse et al. (3) confirmed that Sr12, or a closely linked gene, was responsible for the APR activity against the Ug99-related race TTKSK and discovered that this activity increased through epistatic interactions with two QTLs located on chromosome arms 1AL and 2BS, and in one environment also with Lr34/Sr57.

In 2016 Hiebert et al. (5) fine mapped Sr12 on the centromeric region of chromosome arm 3BL. A major QTL for APR peaked in the same region that was effective to different stem rust pathogen races, including some related to Ug99. At this point it is not known whether the seedling resistance gene Sr12 is also responsible of the APR effect, or if it is closely linked to APR. The authors also determined that Lr34/sr57 interacted with the APR gene to increase its effectiveness.

Markers for Sr12

A QTL for stem rust APR detected in field experiments overlapped with the seedling stage resistance locus Sr12 (5).  This QTL was flanked by SNP markers IWA6086 and IWA4613 and co-segregated with IWA610.  The authors searched the DNA sequence of approximately 55 Mb bound by the flanking SNPs for regions with homology to the nucleotide binding-leucine rich repeat resistance gene family (NB-LRR). Two NB-LRR sequences were detected and KASP markers were developed for both. The marker for one of these sequences, NB-LRR3, co-segregated with seedling resistance and to two SNP markers, IWA610 and IWA537, co-segregated with NB-LRR3.

In addition to the NB-LRR KASP markers, the authors also converted several of the relevant SNPs to KASP. The sequences of all these markers are available on table S1 of the original publication (5, link to the Excel file). Here we show only the sequences of those flanking the QTL, the one co-segregating with Sr12 (IWA6086, IWA4613 and IWA610 respectively) and the marker linked to the NB-LRR motif.

IWA6086F CACTCTCTACCCCTCCACACAC
IWA6086R CACTCTCTACCCCTCCACACAT
IWA6086_common GGGTGAGTAAGCTCGTTTGC
IWA4613F ACGACAGATTGATCTAGACCGGAA
IWA4613R ACGACAGATTGACTAGACCGGAG
IWA4613_common ATCATGGCCAGTGCTTGGT
IWA610F TCCCCCTAAGCTTCCGTTGAG
IWA610R TCCCCCTAAGCTTCCGTTGAA
IWA610_common TGCAAGCCTAGGTAGTATTGGT
NB-LRR3F CAGCAACTCAAGATGCTTCTGAG
NB-LRR3R CAGCAACTCAAGATGCTTCTGAA
NB-LRR3_commmon ATCAGCAGATCACGAGACCAA

Conditions presented here should be considered only as a starting point of the PCR optimization for individual laboratories.

References

1. The inheritance of stem rust resistance in Thatcher wheat. Knott DR. In: Canadian journal of plant science, 2000, 80:53-63. DOI:10.4141/P99-016.

2. Telocentric mapping of Sr12 in wheat chromosome 3B. McIntosh RA, Pertridge M, Hare RA. In: Cereal Research Communication, 1980, 8: 321-324.

3. Complementary epistasis involving Sr12 explains adult plant resistance to stem rust in Thatcher wheat (Triticum aestivum L.). Rouse MN, Talbert LE, Singh D, Sherman JD. In: Theoretical and Applied Genetics, 2014, 127: 1549-1559. DOI:10.1007/s00122-014-2319-6.

4. Genetics of stem rust resistance in the spring wheat cultivar Thatcher and the enhancement of stem rust resistance by Lr34. Vanegas CD, Garvin DF, Kolmer JA. In: Euphytica, 2008, 159:391-401. DOI:10.1007/s10681-007-9541-0.

5. Major gene for field stem rust resistance co-locates with resistance gene Sr12 in ‘Thatcher’ wheat. Hiebert CW, Kolmer JA, McCartney CA, Briggs J, Fetch T, Bariana H, et al. In: PLoS ONE, 2016, 11(6):e0157029. DOI:10.1371/journal.pone.0157029.


Back to top