Home
Protocols section

Disease resistance. Stripe Rust Resistance.

Stripe Rust Epistatic QTL on 4BL

Contributed by Adam Heesacker, Hilary Gunn, Nathalia Moretti, Maria Dolores Vazquez, Chris Mundt, and Robert Zemetra

Background information

In 2007, a new stripe rust (Puccinia striiformis) race was detected which had virulence on all known dominant stripe rust resistance genes except Yr5 and Yr15 (1).  In 2009 the new race had come to be the dominant pathotype affecting wheat in the Pacific Northwest. Since then, there has been a major effort to identify resistance genes effective against the new race as well as durable resistance to stripe rust.  As part of this effort, the Oregon State University Wheat Breeding and Genetics program mapped QTLs for stripe rust resistance in the recombinant inbred line (RIL) populations Stephens × Platte (S×P), Tubbs × NSA98-0995 (T×N), and Einstein × Tubbs (E×T).

The QTL QYrpl.orr-4BL, donated by cultivar Platte (the stripe rust susceptible parent), was first identified in the S×P population (2).  This QTL explained 20% of the phenotypic variation for resistance and a higher level of resistance than expected due to an additive effect (epistasis) found in individuals that had gene combinations that included this QTL.  The same QTL was seen again in the Einstein × Tubbs population (E×T) (3), but was not reported due to the heavily resistant slant of the Einstein × Tubbs resistance phenotypic data and the removal of loci showing high segregation distortion for the mapping.  The E×T genetic map is a consensus of two sub-populations which can be categorized by the alleles contributed by two different Tubbs donors.  Tubbs is known to be heterogeneous since it was an F2 derived release from the cross Malcolm × Madsen, though it is also possible that the Tubbs parent of the E×T population was heterozygous.  The chromosome 4B sub-population 1 does not show segregation distortion but sub-population 2 shows an over-abundance of the Einstein (resistance donor) allele.

Marker development

Once the 9000 SNP Illumina array was made available for genetic mapping in 2012, this resource was used to further fill out the Stephens × Platte genetic map. The QTL QYrpl.orr-4BL was found to be between the loci wsnp_CAP12_c1101_569479 and wsnp_Ex_rep_c67159_65649966.  Using the 9000 SNP composite genetic map provided by Deven See (USDA-ARS, Pullman, WA), a small association study was performed looking at the clustered susceptible parents sharing the same lineage (Tubbs and Stephens) versus the resistant parents sharing the same lineage (Platte and Einstein).

Looking across chromosome 4B, the same QTL was found with the same two markers showing polymorphism (as well as the markers wsnp_Ra_c22026_31453420, wsnp_Ex_c26807_36031771, wsnp_Ex_c26285_35531535).  The two flanking markers were then turned into KASP SNP markers and were given the acronym ERA for Epistatic Resistance Allele (wsnp_Ex_rep_c67159_65649966 = ERA1; wsnp_CAP12_c1101_569479 = ERA2).  Analyzing the E×T population with these markers showed that ERA2 segregated normally in both sub-populations, while ERA1 matched the segregation distortion towards resistance (99% resistance allele) in sub-population 2. The segregation distortion suggests that the two Tubbs haplotypes imparted different parental contributions to the sub-populations.  Both sub-populations received the Malcolm-derived haplotype for ERA2. For ERA1, sub-population 1 received the Malcolm-derived haplotype while sub-population 2 received the Madsen-derived haplotype. Madsen and Einstein share the same haplotype for resistance at this locus leading to non-polymorphic segregation.  A recombination event between Malcolm and Madsen occurred between ERA2 and ERA1 in the lineage leading to the sub-population 2 Tubbs parent.  The cultivar Bobtail, which was selected from the E×T sub-population 2, carries the gene for resistance at this locus passed down from Einstein. 

Due to the breeding program not having sources of resistance for Yr5 and Yr15, negative selection for response to stripe rust was occurring in the field with elimination of all lines showing any susceptibility to stripe rust in the F1 generation, and any segregation of stripe rust 50% or greater population-wise in the F2 and F3 generations.  Lines coming out of this increased selection pressure show a higher frequency of the resistance alleles for markers ERA1 and ERA2 (Table 1). Years on the table reflect F4 to F5 generation selections, so selection in F2 and F3 generations occurred 2 years prior to the year indicated on the table 1.

Table 1

Table 1. Allele frequency table for F4 derived lines from Pacific Northwest breeding programs for the Epistatic resistance allele on 4B.

Now with the publication of the annotated wheat genome sequence (IWGSC 2018) it is possible to look at the region of this QTL in greater detail.  Using the flanking sequences (wsnp_CAP12_c1101_569783 and wsnp_Ex_rep_c67159_65649966 = TraesCS4B02G343800) we found the chromosome region to be at 609513071 637389539. The associated marker wsnp_Ex_c26807_36031771 from the above study is in this region.  Using the polymorphism between Platte and Chinese Spring in this region, KASP SNPs were designed to TraesCS4B02G328500, a Major Facilitator Superfamily gene, one of which (ERA6-3-R2) had distinct and consistent codominant results.  This area for design was decided on because it cut the physical distance of the QTL region in half.  Mapping in the ET population showed that the gene is still closer to ERA1 than the new marker.  Design of KASP markers to the polymorphism in other nearby genes was unsuccessful.  The epistatically interacting gene is likely one of the ABC transporters (TraesCS4B02G332300 and TraesCS4B02G343800) in this region, although a better population is required to finalize this observation.  The slow rusting adult plant resistance gene Yr18/Lr34 was found to be an ABC transporter (Dakouri et al. 2010).

This gene should be used in combination with other genes for greater resistance effect; by itself it has little to no effect.  One strong combination is with Yr17, seen in the cultivars Bobtail, Cara, Madsen, Norwest553, as well as Limagrain cultivars Einstein, Drive, and Jet.  It has been hypothesized that resistance based on multiple gene interactions are harder for pathogens to break, though for this exact combination only time will tell.  KASP marker sequences are given here in Table 2.  If you use this marker to develop a cultivar, please cite this web page and Adam Heesacker, Hilary Gunn, Nathalia Moretti, Maria Dolores Vazquez, Chris Mundt, and Robert Zemetra as webpage authors in your cultivar release.

Gene Function Marker Primer Allele Primer Sequence *
TraesCS4B02G343800 ABC Transporter ERA1 ERA-1A Susceptible TCACAGGATCCCAACGGTCATT
  ERA-1G Resistant TCACAGGATCCCAACGGTCATC
  ERA-1R   ACCGTCGCTAAGCACCATGA
TraesCS4B02G328500 Major Facilitator Superfamily ERA6-3-R2 YrERA_6-3-T Resistant GGTGCGTCACAACTCTACT
  YrERA_6-3-A Susceptible GGTGCGTCACAACTCTACA
  YrERA_6-3-R2   TACTTGGGTAGAGCGACGACT

Table 2. KASP SNP markers for ERA. (*) Adapter must be added to make KASP marker functional

ERA1ERA6-3-R2  

Conditions presented here should be considered only as a starting point of the PCR optimization for individual laboratories.

References

  1. Virulence races of Puccinia striiformis f. sp tritici in 2006 and 2007 and development of wheat stripe rust and distributions, dynamics, and evolutionary relationships of races from 2000 to 2007 in the United States. Chen XM, Penman L, Wan A, Cheng P. In: Canadian Journal of Plant Pathology, 2010, 32:315-333. DOI: 10.1080/07060661.2010.499271.

  2. Genetic Analysis of Adult Plant, Quantitative Resistance to Stripe Rust in Wheat Cultivar ‘Stephens’ in Multi-environment Trials. Vazquez MD, Peterson CJ, Riera-Lizarazu O, Chen XM, Heesacker AF, Ammar K, Crossa J, Mundt CC. In: Theoretical and Applied Genetics, 2012, 124:1-11. DOI: 10.1007/s00122-011-1681-x.

  3. Multi-location wheat stripe rust QTL analysis: Genetic background and epistatic interactions. Vazquez MD, Zemetra RC, Peterson CJ, Chen XM, Heesacker AF, Mundt CC. In: Theoretical and Applied Genetics, 2015, 7:1307-1318.DOI: 10.1007/s00122-015-2507-z.

  4. Shifting the limits in wheat research and breeding using a fully annotated reference genome. International Wheat Genome Sequencing Consortium IWGSC. In: Science, 2018, 361:661-674. DOI: 10.1126/science.aar7191.

  5. Fine-mapping of the leaf rust Lr34 locus in Triticum aestivum (L.) and characterization of large germplasm collections support the ABC transporter as essential for gene function. Dakouri A, McCallum BD, Walichnowski AZ, Cloutier S. In: Theoretical and Applied Genetics, 2010, 121:373-384. DOI: 10.1007/s00122-010-1316-7.


Back to top