Kernel size gene TaGW8

We acknowledge the additional information contributed by Dr. Tian Li

GW8 is a rice QTL that was mapped to locus OsSPL16, which encodes a protein that is a positive regulator of cell proliferation. An increment in the transcription rate of this gene is associated with a promotion of cell division and grain filling that positively impact grain width and yield. Sequence analysis of the protein coded by OsSPL16 suggested it was a Squamosa promoter-binding protein–like 16 (SPL),  one instance of the SBP domain family of transcription factors. However, when the transcription levels of genes known to be involved in grain size were measured, no differences were detected in rice plants with a high-yield (GW8) or low yield (gw8) variants.  Instead, there were differences in transcription levels for genes involved in cell cycle regulation, both at the G1-to-S and G2-to-M transitions (1).

In a study published in early 2019, Cao et al (2) cloned and characterized TaSPL16, a wheat orthologous gene of OsSPL16. The authors found three TaSPL16 homeologs on the short arms of chromosome 7A, 7B, and 7D.  Their higher expression levels observed in young panicles and the effects induced by the ectopic expression of TaSPL16 in Arabidopsis suggested its involvement in regulatory processes.

In another study also published in 2019, Yan et al. (3) carried out a genome-wide association study on a panel of Chinese wheat cultivars and mapped one the homeologs of TaGW8 on chromosome 7B, which affected kernel length and thousand-kernel weight, and named the candidate gene TaGW8-B1. These authors cloned the gene by sequencing several Chinese cultivars and found two variants based on the presence of 276-bp indel in the first intron. The variant lacking the indel sequence was designated TaGW8-B1a and the indel-carrying variant, TaGW8-B1bCultivars with TaGW8-B1a showed significantly wider kernel width, significantly more kernels per spike, longer kernel length, higher thousand-kernel weight, more spikelets per spike and significantly higher yield than cultivars with TaGW8-B1b. Additionally, expression analysis with qRT-PCR indicated that cultivars with TaGW8-B1a had significantly higher transcription levels than cultivars with TaGW8-B1b.

Later the same year, Ma et al. (4) cloned the three homeologs of TaGW8 from Chinese Spring and analyzed their sequence variations on a large cultivar panel, their effects on yield components and transcription patterns. Each gene, TaGW8-7A, TaGW8-7B and TaGW8-7D, consisted of three exons and two intronsTaGW8-7A showed higher sequence variation than TaGW8-7B or TaGW8-7D. The sequence variants of TaGW8-7A were grouped in four haplotypes (Hap-1/2/3/4). TaGW8-7A-Hap-2 was associated with higher thousand-grain weight, larger kernel length and higher transcriptional levels than the other haplotypes. The authors found two haplotypes for TaGW8-7B (Hap-L/H). Haplotype TaGW8-7B-Hap-H had higher expression levels and was associated with early heading and maturity, lower tiller number and higher thousand-grain weight. In the germplasm used for the study, TaGW8-7D presented only two variants of low frequency, and they were not analyzed. 

The fact that TaGW8-7A and TaGW8-7B affect different traits suggests that they diverged in their functionality, and that could be used together in breeding programs. Data presented by Ma et al. (4) indicate both genes do have an additive effect thousand-grain weight, with TaGW8-7B showing an stronger one. Nonetheless, it is important to note that the favorable allele TaGW8-7B-Hap-H is already present in many cultivars worldwide. On the other hand, the frequency of TaGW8-7A-Hap-2 is relatively low outside China.

How do the alleles of TaGW8-7B reported by Yan et al. (3) and Ma et al. (4) compare to each other? In the paper of Yan et. al the variant lacking the 276-bp insertion was designated TaGW8-B1a and in Ma et al. it is TaGW8-7B-Hap-H. The sequence analysis of Ma et al. extended upstream into the promoter region, where they found three additional SNPs, that could be responsible for the changes in expression levels between alleles. The results of the comparative field test involving agronomic and yield components for these variants showed some differences in both papers. So that, it is recommended to run tests before starting a selection program for the 7B homeolog.

Markers for TaGW8

Markers for TaGW8-7B, Yan et al. (3)

Primer sequences:

GW8-7B-F

5'- CGCTCATCCATTCCTTCATCG -3'

GW8-7B-R

5'- GCTATATGGGTTGGTGTCGC -3'

Annealing temperature: 60°C

Expected products: TaGW8-B1a amplifies a band of 1097-bp, and TaGW8-B1b one band of 1373-bp. For a gel image, see Fig. 4 of Ref. 3 (link)

Markers for TaGW8 homeologs, Ma et al. (4)

Primer sequences for TaGW8-7A alleles:

TaGW8-7A189F

5'- CATGGACTGGGATCTCAAG -3'

TaGW8-7A189R

5'- GCCTTAGAAAATACTCCTCCT -3'

TaGW8-7A245F

5'- TTGCTTGTATTGTTGCCCCAT -3'

TaGW8-7A245R

5'- CGATGAAGGGAGCGAAGAGAA -3'

TaGW8-7A4550F

5'- GGCAGTTCCATCATCTTCTTG -3'

TaGW8-7A4550R

5'- AGAGAGAAGAGACACGAACAG -3'

Digestion with restriction enzymes

  • Marker TaGW8-7A189 requires an additional step of digestion with restriction enzyme MvaI. 
  • Marker TaGW8-7A4550 requires an additional step of digestion with restriction enzyme SalI.

Expected products:

  • TaGW8-7A189 detects a G/C SNP in position 189.
  • TaGW8-7A245 reveals an indel of 65-bp in position 245
  • TaGW8-7A4550 detects a G/A SNP at position 4550

SNPs and size of diagnostic bands, in parenthesis, for the four haplotypes of TaGW8-7A:

Haplotype TaGW8-7A189 TaGW8-7A245 TaGW8-7A4550
TaGW8-7A-Hap-1 C (680-bp) Insertion (1071-bp) A (700-bp)
TaGW8-7A-Hap-2 G (189- and 491-bp) Insertion (1071-bp) A (700-bp)
TaGW8-7A-Hap-3 C (680-bp) Insertion (1071-bp) G (509-bp and 191-bp)
TaGW8-7A-Hap-4 deletion Deletion (942-bp) A (700-bp)  

 

Primer sequences for TaGW8-7B alleles:

TaGW8-7B1280F

5'- CCTTTTCCATGTGCATTGT -3

TaGW8-7B1280R

5'- TAAGTAGGATTTGACGCCTT -3'

Expected products:

TaGW8-7B-Hap-L: one band of 876-bp 

TaGW8-7B-Hap-H: one band of 600-bp

Conditions presented here should be consider only as a starting point of the method optimization at individual laboratories.

References

1. Control of grain size, shape and quality by OsSPL16 in rice. Wang S, Wu K, Yuan Q, Liu X, Liu Z, Lin X, Zeng R, Zhu H, Dong G, Qian Q, Zhang G, Fu X. In:  Nature Genetics, 2012, 44:950-954. DOI:10.1038/ng.2327

2. Identification and Functional Characterization of Squamosa Promoter Binding Protein-Like Gene TaSPL16 in Wheat (Triticum aestivum L.). Cao R, Guo L, Ma M, Zhang W, Liu X, Zhao H. In: Frontiers in Plant Science, 2019, 212. DOI:10.3389/fpls.2019.00212

3. Genome-wide association study revealed that the TaGW8 gene was associated with kernel size in Chinese bread wheat. Yan X,Zhao L,Ren Y,Dong Z,Cui D,Chen F. In: Scientific Reports, 2019, 9:2702. DOI:10.1038/s41598-019-38570-2

4. Diversity and sub-functionalization of TaGW8 homoeologs hold potential for genetic yield improvement in wheat. Ma L, Hao C, Liu H, Hou J, Li T, Zhang X. In: The Crop Journal, 2019, 7:830-844. DOI:10.1016/j.cj.2019.09.006

 

Tags